FLAG tag Peptide (DYKDDDDK): Atomic Facts for Protein Purification

Executive Summary: The FLAG tag Peptide (DYKDDDDK) is an 8-amino acid synthetic peptide used as an epitope tag for recombinant protein purification and detection (APExBIO). It enables specific, reversible binding to anti-FLAG M1/M2 affinity resins, supporting gentle elution by competitive peptide or enterokinase cleavage (Miyoshi et al., 2021). The peptide demonstrates high solubility (>210.6 mg/mL in water, >50.65 mg/mL in DMSO) and purity (>96.9% by HPLC/MS), ensuring reproducible workflows. It is not suitable for eluting 3X FLAG fusion proteins, for which a 3X FLAG peptide is required. The peptide is a cornerstone for modern protein purification, outperforming several traditional tag systems (site article).

Biological Rationale

Eukaryotic and prokaryotic recombinant protein expression systems often require fusion tags to facilitate purification, detection, and downstream applications. The FLAG tag Peptide (DYKDDDDK) is designed as a minimal, hydrophilic epitope recognized by high-affinity monoclonal antibodies (M1 and M2 clones) (Miyoshi et al., 2021). The sequence DYKDDDDK is derived to minimize interference with protein folding and function. It incorporates an enterokinase cleavage site (DDDDK), allowing for tag removal under mild conditions. Compared to larger tags, the FLAG tag’s small size reduces immunogenicity and steric hindrance (Mechanistic Insights Article). This article extends prior reviews by providing atomic, quantitative benchmarks and explicit use-case boundaries.

Mechanism of Action of FLAG tag Peptide (DYKDDDDK)

The FLAG tag Peptide acts as an epitope tag by being genetically fused to the N- or C-terminus of a recombinant protein. Upon cell lysis, the tagged protein binds specifically to anti-FLAG M1 or M2 monoclonal antibodies immobilized on affinity resins. Elution can be achieved by competition with excess free FLAG peptide or by enzymatic cleavage using enterokinase. The peptide's DYKDDDDK sequence is recognized with high specificity, enabling selective isolation even from complex lysates (Miyoshi et al., 2021). The efficacy relies on both the affinity of the antibody and the solubility of the peptide, which permits high-concentration competitive elution without precipitation or nonspecific binding. The product from APExBIO (A6002) is supplied as a solid, facilitating precise dosing for reproducible workflows (APExBIO).

Evidence & Benchmarks

• The FLAG tag Peptide (DYKDDDDK) supports specific detection and purification of recombinant proteins in western blotting, immunoprecipitation, and ELISA (Miyoshi et al., 2021).
• Monoclonal antibodies (M1, M2) developed against the FLAG tag show fast dissociation rates, with half-lives of 0.98–2.2 seconds, enabling reversible binding and gentle elution (Miyoshi et al., 2021, Table 1).
• Peptide solubility benchmarks: >210.6 mg/mL in water, >50.65 mg/mL in DMSO, >34.03 mg/mL in ethanol (at 20–25°C; neutral pH) (APExBIO).
• The product is supplied at >96.9% purity, confirmed by HPLC and mass spectrometry (APExBIO).
• The FLAG tag sequence (DYKDDDDK) contains a canonical enterokinase site, enabling specific cleavage and tag removal post-purification (site review).
• Solutions are stable when freshly prepared and used promptly; long-term storage of peptide solutions is not recommended (APExBIO).
• The FLAG tag does not cross-react with 3X FLAG fusion proteins; a 3X FLAG peptide is required for those constructs (site atomic facts).

Applications, Limits & Misconceptions

The FLAG tag Peptide is used for:

• Affinity purification of recombinant proteins from E. coli, yeast, insect, and mammalian cell lysates.
• Detection in western blotting, immunostaining, flow cytometry, and ELISA via anti-FLAG antibodies.
• Elution of FLAG-tagged proteins from anti-FLAG resins using competitive peptide or enterokinase cleavage.
• Quantitative workflows demanding high solubility and reproducibility.

Compared to prior articles (workflow article), this article details the peptide’s purity benchmarks and clarifies boundaries for use in 3X FLAG systems.

Common Pitfalls or Misconceptions

• The FLAG tag Peptide (DYKDDDDK) will not elute 3X FLAG fusion proteins; a 3X FLAG peptide is required.
• Long-term storage of peptide solutions can lead to degradation; always prepare fresh solutions for each experiment.
• The tag may not be suitable for applications requiring removal in non-enterokinase-compatible buffers.
• High concentrations of peptide may cause nonspecific elution if the resin is overloaded or improperly washed.
• Not all anti-FLAG antibodies are compatible with every detection method; M1 and M2 clones have different calcium and binding requirements.

Workflow Integration & Parameters

For protein purification workflows, the FLAG tag is genetically fused to the target protein using a codon-optimized DNA sequence (FLAG tag DNA/nucleotide sequence: GACTACAAGGACGACGATGACAAG). Expression is induced in the host system, and cells are lysed under native or denaturing conditions. Lysates are incubated with anti-FLAG M1 or M2 affinity resin. Washing steps remove nonspecific proteins. Elution occurs with 100 μg/mL of FLAG tag Peptide (DYKDDDDK) or by enterokinase cleavage, depending on experimental goals. The high solubility of the peptide ensures efficient elution with minimal sample dilution. Storage of the solid peptide is recommended at -20°C in a desiccated environment; shipping is on blue ice (APExBIO).

For detection, monoclonal antibodies (M1, M2) are used in western blotting or immunofluorescence. The reversible binding property has enabled advanced imaging such as single-molecule TIRF and diSPIM super-resolution techniques (Miyoshi et al., 2021).

For a comprehensive protocol and troubleshooting guide, see the workflow article, which this article updates by providing latest purity and solubility benchmarks relevant for high-throughput and single-molecule workflows.

Conclusion & Outlook

The FLAG tag Peptide (DYKDDDDK) remains a gold standard for epitope tagging in recombinant protein purification and detection. Its high specificity, exceptional solubility, and gentle elution make it a preferred choice for molecular biology and proteomics. The APExBIO product (A6002) offers validated purity and performance, supporting robust and reproducible workflows. Ongoing advances in antibody engineering, super-resolution microscopy, and automated screening further extend the utility of the FLAG tag system (Miyoshi et al., 2021). For the latest product specifications and protocols, visit the official product page.