FLAG tag Peptide (DYKDDDDK): Atomic Facts for Protein Pur...
FLAG tag Peptide (DYKDDDDK): Atomic Facts for Protein Purification
Executive Summary: The FLAG tag Peptide (DYKDDDDK) is an eight–amino acid synthetic sequence that enables efficient purification and detection of recombinant proteins across diverse systems (Tang et al., 2025). Its structure incorporates an enterokinase cleavage site, allowing gentle elution from anti-FLAG M1 and M2 affinity resins. The peptide exhibits high solubility in DMSO (>50.65 mg/mL), water (210.6 mg/mL), and ethanol (34.03 mg/mL). Analytical verification by HPLC and mass spectrometry demonstrates purity >96.9%. The product—available from APExBIO as the FLAG tag Peptide (DYKDDDDK), SKU A6002—is widely adopted in protein purification and detection applications, with usage parameters optimized for 100 μg/mL working concentration.
Biological Rationale
Epitope tagging is a foundational strategy in molecular biology, enabling the selective purification and detection of recombinant proteins. The FLAG tag Peptide (DYKDDDDK) is a synthetic peptide composed of eight amino acids (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys), engineered to minimize interference with protein folding and function (Tang et al., 2025). It is specifically recognized by anti-FLAG antibodies, facilitating affinity purification workflows. The tag’s small size reduces the risk of perturbing the biochemical properties of the target protein (see also: Benchmarks for Epitope Tag-Based Purification). This article extends such discussions by providing rigorous, protocol-level detail and explicit quantitative benchmarks.
Mechanism of Action of FLAG tag Peptide (DYKDDDDK)
The FLAG tag sequence (DYKDDDDK) functions as an epitope, enabling the selective capture of FLAG-tagged fusion proteins by anti-FLAG M1 or M2 affinity resins. The key features of the mechanism are:
- Epitope Recognition: The aspartic acid-rich motif is specifically bound by monoclonal anti-FLAG antibodies, which are immobilized on agarose or magnetic beads (Tang et al., 2025).
- Enterokinase Cleavage Site: The sequence includes an enterokinase recognition site, allowing site-specific cleavage and release of the fusion protein under gentle, non-denaturing conditions (APExBIO Product Page).
- Elution: Elution is achieved by competitive displacement using excess FLAG tag Peptide or by enzymatic cleavage (only for single-DYKDDDDK tags; does not elute 3X FLAG constructs).
- Minimal Interference: The tag rarely disrupts protein structure, function, or localization due to its compactness (Atomic Facts & Benchmarks).
Evidence & Benchmarks
- CDK8 subunits fused to a C-terminal FLAG tag (DYKDDDDK) retain full kinase activity and stability in the human CKM-cMED complex (Tang et al., 2025).
- The FLAG tag enables high-specificity purification from nuclear extracts using anti-FLAG M2 affinity gel, as demonstrated in Freestyle 293-F cell systems (Tang et al., 2025).
- Purity of commercial FLAG tag Peptide (A6002) is >96.9%, confirmed by HPLC and mass spectrometry (APExBIO Product Page).
- The peptide is highly soluble: 210.6 mg/mL in water, >50.65 mg/mL in DMSO, and 34.03 mg/mL in ethanol at ambient temperature (APExBIO).
- Optimal working concentration for elution is 100 μg/mL in most biochemical assays (APExBIO).
- 3X FLAG tags are not efficiently eluted by single DYKDDDDK peptides; specialized reagents are required (Atomic Facts & Benchmarks).
Applications, Limits & Misconceptions
The FLAG tag Peptide (DYKDDDDK) is broadly used in recombinant protein purification, detection assays (e.g., western blot, ELISA), immunoprecipitation, and affinity chromatography. It is especially valuable in large, multi-protein complex isolation—such as the Mediator complex—where gentle elution preserves protein activity (Tang et al., 2025). This article updates recent reviews by providing explicit workflow integration and evidence-backed troubleshooting for advanced users (see also: Transforming Recombinant Protein Purification).
Common Pitfalls or Misconceptions
- 3X FLAG tags are not eluted by single DYKDDDDK peptides. For such constructs, use a specialized 3X FLAG peptide reagent (APExBIO).
- Long-term peptide solution storage is discouraged. Prepare solutions fresh; store dry at -20°C, desiccated (APExBIO).
- Elution efficacy depends on antibody clone and buffer composition. Validate conditions for your specific anti-FLAG resin (see also: Precision Epitope Tag for Recombinant Protein Workflows).
- The FLAG tag may occasionally affect protein localization. Empirical validation is recommended for each fusion construct.
- Not all anti-FLAG antibodies recognize engineered FLAG variants. Use validated commercial antibodies for consistency.
Workflow Integration & Parameters
For affinity purification, the FLAG tag Peptide (DYKDDDDK) is typically fused to the N- or C-terminus of the protein of interest at the DNA level. The recommended workflow is:
- Clone the flag tag DNA sequence (GACTACAAGGACGACGATGACAAG) in-frame with the target gene.
- Express the fusion protein in systems such as Freestyle 293-F cells (Tang et al., 2025).
- Lyse cells and apply lysate to anti-FLAG M1 or M2 affinity resin.
- Wash and elute the fusion protein using 100 μg/mL of synthetic FLAG tag Peptide (A6002) in suitable buffer (e.g., TBS, pH 7.4).
- For complete removal of the tag, use enterokinase to cleave the DYKDDDDK sequence.
Parameters:
- Solubility: 210.6 mg/mL (water), >50.65 mg/mL (DMSO), 34.03 mg/mL (ethanol).
- Purity: >96.9% (HPLC, MS).
- Storage: -20°C, desiccated; avoid repeated freeze-thaw cycles.
- Working concentration: 100 μg/mL for elution.
- Shipping: Blue ice for small molecule orders.
Conclusion & Outlook
The FLAG tag Peptide (DYKDDDDK) is a rigorously validated, high-purity epitope tag that supports gentle, high-fidelity purification of recombinant proteins. Its compatibility with anti-FLAG affinity resins and enterokinase cleavage provides exceptional workflow flexibility. Ongoing advances in structural biology continue to leverage the unique properties of this tag for multi-protein complex isolation (Tang et al., 2025). For full product specifications and ordering, refer to the APExBIO FLAG tag Peptide (DYKDDDDK) product page.